lipofectamine dna ratio in optimem (Thermo Fisher)
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 
99
Structured Review
Thermo Fisher
lipofectamine dna ratio in optimem
Lipofectamine Dna Ratio In Optimem, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lipofectamine+dna+ratio+in+optimem/DNA/pm41390669-240-13-17
Average 99 stars, based on 1 article reviews
Lipofectamine Dna Ratio In Optimem, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lipofectamine+dna+ratio+in+optimem/DNA/pm41390669-240-13-17
Average 99 stars, based on 1 article reviews
lipofectamine dna ratio in optimem - by Bioz Stars,
2026-11
99/100 stars
Images
Related Articles
other:Article Title: Targeted CRISPR-Cas9 screening identifies core transcription factors controlling murine haemato-endothelial fate commitment. Article Snippet: pRR-Puro recombination reporter54 (Addgene 65853) was co-transfected and after 36 hours, cells were treated with 2 μg/ml of puromycin for another 36 hours. Transfection:Article Title: Targeted CRISPR-Cas9 screening identifies core transcription factors controlling murine haemato-endothelial fate commitment Article Snippet: .. Transfections were conducted using Article Title: Dissecting the roles of MBD2 isoforms in regulating NuRD complex function during cellular differentiation Article Snippet: The MBD2 KO and MBD3 KO cell lines were generated by co-transfecting pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene 42230) with two sgRNA targeting exon 1 for MBD2 KO cell line (sg1_GACTCCGCCATAGAGCAGGG, sg2_CCCCCCCGGATGGAAGAAGG) and exon 2 and exon 3 for MBD3 KO cell line (sg1_CAACTGGCACGTTACCTGGG, sg2_CACCAACCACCCCAGCAACA), respectively. pRR-Puro recombination reporter ( ) (Addgene 65853) was co-transfected and 36 hours after transfection, cells were treated with 2 μg/ml puromycin for 36 h. Positive KO clones were validated by Sanger sequencing and western blotting. .. Transfections were conducted using Article Title: Dissecting the roles of MBD2 isoforms and domains in regulating NuRD complex function during cellular differentiation. Article Snippet: For the generation of the MBD2/3 DKO cell line the targeting was performed consecutively, first MBD2 single KO cell line # 10 was generated and then exon 2 and exon 3 of MBD3 was targeted (sg1_CAACTGGCACGTTACCTGGG, sg2_CACCAACCACCCCAGCAAC A), respectively. pRR-Puro recombination reporter47 (Addgene 65853) was co-transfected and 36 hours after transfection cells were treated with 2 μg/ml puromycin for 36 h. Positive KO clones were validated by Sanger sequencing and immunoblotting. .. Transfections were conducted using Article Title: Dissecting the roles of MBD2 isoforms and domains in regulating NuRD complex function during cellular differentiation Article Snippet: For the generation of the MBD2/3 DKO cell line the targeting was performed consecutively, first MBD2 single KO cell line # 10 was generated and then exon 2 and exon 3 of MBD3 was targeted (sg1_CAACTGGCACGTTACCTGGG, sg2_CACCAACCACCCCAGCAACA), respectively. pRR-Puro recombination reporter (Addgene 65853) was co-transfected and 36 hours after transfection cells were treated with 2 μg/ml puromycin for 36 h. Positive KO clones were validated by Sanger sequencing and immunoblotting. .. Transfections were conducted using Article Title: Targeted CRISPR-Cas9 screening identifies transcription factor network controlling murine haemato-endothelial fate commitment Article Snippet: Ctrl samples were transfected with non-targeting sgRNAs (sgRNA1_GCGTATCTACCCTACCGCCG, sgRNA2_GCGGTTACCGCGAAAACCAT). pRR-Puro recombination reporter (Addgene 65853) was co-transfected and 36 hours after transfection cells were treated with 2 μg/ml puromycin for 36 h. Positive KO clones were validated by Sanger sequencing. .. Transfections were conducted using Article Title: SETD2 promotes PAF1C interactions with the elongating RNA Pol II and is required for neuronal differentiation Article Snippet: The Cas9 sgRNA sequences as previously described , were cloned into the pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene 42230). .. Transfections together with pRR-Puro recombination reporter (Addgene 65853) were conducted using |